circad | circRNAs associated with diseases

circHIPK3
Gene	HIPK3	Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	29415990
Experimental Method
Sample Type	Tissue and cell lines	Comparison	50 patient tissues versus control
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TATGTTGGTGGATCCTGTTCGGCA Reverse TGGTGGGTAGACCAAGACTTGTGA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Chen, G, Shi, Y, Liu, M, Sun, J (2018). circHIPK3 regulates cell proliferation and migration by sponging miR-124 and regulating AQP3 expression in hepatocellular carcinoma. Cell Death Dis, 9, 2:175.